Online Inquiry
PIP4K2B Knockout Cell Line
SPL-02587
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
22bp deletion |
Target Information | |
---|---|
Target Name | PIP4K2B |
Gene Abbr. | PIP4K2B |
Gene ID | 8396 |
Full Name | phosphatidylinositol-5-phosphate 4-kinase type 2 beta |
Alias | PI5P4KB, PIP5K2B, PIP5KIIB, PIP5KIIbeta, PIP5P4KB |
Species | Human |
Genomic Locus | chr17:38784311 |
Transcript | NM_003559 |
WT Expression Level | 21.23 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene catalyzes the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. The encoded protein sequence does not show similarity to other kinases, but the protein does exhibit kinase activity. Additionally, the encoded protein interacts with p55 TNF receptor. [provided by RefSeq, Jul 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 22bp deletion in a coding exon of PIP4K2B. |
Description | 22bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TAAACTTAAAGCGGCTGGGC |
PCR Primer |
Forward: CCAACACGTTTTGATTCTCTACCTG Reverse: CAACTCCAGAATTCCTAAGAGCCTA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.