Online Inquiry
PIP4K2A Knockout Cell Line
SPL-02585
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 121bp deletion |
| Target Information | |
|---|---|
| Target Name | PIP4K2A |
| Gene Abbr. | PIP4K2A |
| Gene ID | 5305 |
| Full Name | phosphatidylinositol-5-phosphate 4-kinase type 2 alpha |
| Alias | PI5P4KA, PIP5K2A, PIP5KII-alpha, PIP5KIIA, PIPK |
| Species | Human |
| Genomic Locus | chr10:22609668 |
| Transcript | NM_005028 |
| WT Expression Level | 29.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Phosphatidylinositol-5,4-bisphosphate, the precursor to second messengers of the phosphoinositide signal transduction pathways, is thought to be involved in the regulation of secretion, cell proliferation, differentiation, and motility. The protein encoded by this gene is one of a family of enzymes capable of catalyzing the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. The amino acid sequence of this enzyme does not show homology to other kinases, but the recombinant protein does exhibit kinase activity. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 121bp deletion in a coding exon of PIP4K2A. |
| Description | 121bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TCATCTGGCATCAACATAAC |
| PCR Primer |
Forward: TTCATCAGCAAAACTTTACTCCCAC Reverse: CAGGAAGAGAGATTATGATGGCAGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.