PIM3 Knockout Cell Line - CD BioSciences

service-banner

PIM3 Knockout Cell Line

PIM3 Knockout Cell Line

SPL-02578

Size Price
1 Unit Online Inquiry
Description
16bp deletion
Target Information
Target Name PIM3
Gene Abbr. PIM3
Gene ID 415116
Full Name Pim-3 proto-oncogene, serine/threonine kinase
Alias pim-3
Species Human
Genomic Locus chr22:49961205
Transcript NM_001001852
WT Expression Level 18.87 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene belongs to the Ser/Thr protein kinase family, and PIM subfamily. This gene is overexpressed in hematological and epithelial tumors and is associated with MYC coexpression. It plays a role in the regulation of signal transduction cascades, contributing to both cell proliferation and survival, and provides a selective advantage in tumorigenesis. [provided by RefSeq, Jun 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 16bp deletion in a coding exon of PIM3.
Description 16bp deletion
Parental Cell Line C631
Guide RNA Sequence GCGGGTAGCCGCATCGCCGA
PCR Primer Forward: TGTAAAACGACGGCCAGCGGACAAGGAGAGCTTCGAG
Reverse: TCCACAAGCAGATTTTCGTCCTTA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.