PIK3R6 Knockout Cell Line - CD BioSciences

service-banner

PIK3R6 Knockout Cell Line

PIK3R6 Knockout Cell Line

SPL-02571

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name PI3K
Gene Abbr. PIK3R6
Gene ID 146850
Full Name phosphoinositide-3-kinase regulatory subunit 6
Alias C17orf38, HsT41028, p84 PIKAP, p87(PIKAP), p87PIKAP
Species Human
Genomic Locus chr17:8838581
Transcript NM_001010855
WT Expression Level 0.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 7. The orthologous protein in the mouse binds to both the catalytic subunit and to G(beta/gamma), and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of PIK3R6.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GAAGAATGCGGACCAGCACT
PCR Primer Forward: GTAAAAATCATGCAGGCAACCAAAG
Reverse: TAGCTCCACTTCCAAACCTAATTCC
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.