Online Inquiry
PIK3R6 Knockout Cell Line
SPL-02570
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 14bp deletion |
| Target Information | |
|---|---|
| Target Name | PI3K |
| Gene Abbr. | PIK3R6 |
| Gene ID | 146850 |
| Full Name | phosphoinositide-3-kinase regulatory subunit 6 |
| Alias | C17orf38, HsT41028, p84 PIKAP, p87(PIKAP), p87PIKAP |
| Species | Human |
| Genomic Locus | chr17:8838581 |
| Transcript | NM_001010855 |
| WT Expression Level | 0.03 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Phosphoinositide 3-kinase gamma is a lipid kinase that produces the lipid second messenger phosphatidylinositol 3,4,5-trisphosphate. The kinase is composed of a catalytic subunit and one of several regulatory subunits, and is chiefly activated by G protein-coupled receptors. This gene encodes a regulatory subunit, and is distantly related to the phosphoinositide-3-kinase, regulatory subunit 5 gene which is located adjacent to this gene on chromosome 7. The orthologous protein in the mouse binds to both the catalytic subunit and to G(beta/gamma), and mediates activation of the kinase subunit downstream of G protein-coupled receptors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 14bp deletion in a coding exon of PIK3R6. |
| Description | 14bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAGAATGCGGACCAGCACT |
| PCR Primer |
Forward: GTAAAAATCATGCAGGCAACCAAAG Reverse: TAGCTCCACTTCCAAACCTAATTCC |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.