PIK3R6 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PIK3R6 cDNA ORF Clone, Human, untagged

PIK3R6 cDNA ORF Clone, Human, untagged

SPD-11422

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 6
Target Information
Species Human
Target Name PI3K
Gene Abbr. PIK3R6
Gene ID 146850
Full Name phosphoinositide-3-kinase regulatory subunit 6
Alias C17orf38, HsT41028, p84 PIKAP, p87(PIKAP), p87PIKAP
Product Details
Description Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 6
NCBI Ref Seq NM_001010855.3
RefSeq ORF Size 2265 bp
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.