Online Inquiry
PIK3R4 cDNA ORF Clone, Human, untagged
SPD-11421
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 4. |
Target Information | |
---|---|
Species | Human |
Target Name | PI3K |
Gene Abbr. | PIK3R4 |
Gene ID | 30849 |
Full Name | phosphoinositide-3-kinase regulatory subunit 4 |
Alias | VPS15, p150 |
Introduction | Three distinct types of phosphoinositide 3-kinases (PI3K) have been characterized. Unlike other PI3Ks, PI3K class III catalyzes the phosphorylation of phosphatidylinositol at the D3 position, producing phosphatidylinositol-3-phosphate (PIP3). PI3K class III is the mammalian homolog of Vps34, first identified in yeast. PI3K class III interacts with the regular subunit p150, the mammalian homolog of Vps15, which regulates cellular membrane association through myristoylation. PIP3 recruits several proteins with FYVE or PX domains to membranes regulating vesicular transport and protein sorting. Moreover, PI3K class III has been shown to regulate autophagy, trimeric G-protein signaling, and the mTOR nutrient-sensing pathway. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 4. |
NCBI Ref Seq | NM_014602.2 |
RefSeq ORF Size | 4077 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence except for the point mutation 1515T/C not causing the amino acid variation. |
Vector | pCMV3-untagged |
Promoter | Enhanced CMV promoter |
Restriction Sites | HindIII + PmeI (6.1kb + 4.08kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Ampicillin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.