PIK3R4 cDNA ORF Clone, Human, N-HA tag - CD BioSciences

service-banner

PIK3R4 cDNA ORF Clone, Human, N-HA tag

PIK3R4 cDNA ORF Clone, Human, N-HA tag

SPD-11420

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 4 with N terminal HA tag.
Target Information
Species Human
Target Name PI3K
Gene Abbr. PIK3R4
Gene ID 30849
Full Name phosphoinositide-3-kinase regulatory subunit 4
Alias VPS15, p150
Introduction Three distinct types of phosphoinositide 3-kinases (PI3K) have been characterized. Unlike other PI3Ks, PI3K class III catalyzes the phosphorylation of phosphatidylinositol at the D3 position, producing phosphatidylinositol-3-phosphate (PIP3). PI3K class III is the mammalian homolog of Vps34, first identified in yeast. PI3K class III interacts with the regular subunit p150, the mammalian homolog of Vps15, which regulates cellular membrane association through myristoylation. PIP3 recruits several proteins with FYVE or PX domains to membranes regulating vesicular transport and protein sorting. Moreover, PI3K class III has been shown to regulate autophagy, trimeric G-protein signaling, and the mTOR nutrient-sensing pathway.
Product Details
Description Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 4 with N terminal HA tag.
NCBI Ref Seq NM_014602.2
RefSeq ORF Size 4119 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence except for the point mutations: 1557T/C not causing the amino acid variation.
Vector pCMV3-N-HA
Promoter Enhanced CMV promoter
Tag Sequence HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Restriction Sites HindIII + NotI (6kb + 4.12kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.