Online Inquiry
PIK3R3 Knockout Cell Line
SPL-02569
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp deletion |
| Target Information | |
|---|---|
| Target Name | PI3K |
| Gene Abbr. | PIK3R3 |
| Gene ID | 8503 |
| Full Name | phosphoinositide-3-kinase regulatory subunit 3 |
| Alias | p55, p55-GAMMA, p55PIK |
| Species | Human |
| Genomic Locus | chr1:46080714 |
| Transcript | NM_003629 |
| WT Expression Level | 11.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Phosphatidylinositol 3-kinase (PI3K) phosphorylates phosphatidylinositol and similar compounds, which then serve as second messengers in growth signaling pathways. PI3K is composed of a catalytic and a regulatory subunit. The protein encoded by this gene represents a regulatory subunit of PI3K. The encoded protein contains two SH2 domains through which it binds activated protein tyrosine kinases to regulate their activity. [provided by RefSeq, Jun 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of PIK3R3. |
| Description | 7bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GCTGAAGTCATTGGCTTAGG |
| PCR Primer |
Forward: TGCCCAGCTTAAAATGGTTTACTTT Reverse: GCATGTTGTCTTTTGAGAGATGTGA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.