PIK3R3 Knockout Cell Line - CD BioSciences

service-banner

PIK3R3 Knockout Cell Line

PIK3R3 Knockout Cell Line

SPL-02568

Size Price
1 Unit Online Inquiry
Description
4bp deletion
Target Information
Target Name PI3K
Gene Abbr. PIK3R3
Gene ID 8503
Full Name phosphoinositide-3-kinase regulatory subunit 3
Alias p55, p55-GAMMA, p55PIK
Species Human
Genomic Locus chr1:46080714
Transcript NM_003629
WT Expression Level 11.90 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Phosphatidylinositol 3-kinase (PI3K) phosphorylates phosphatidylinositol and similar compounds, which then serve as second messengers in growth signaling pathways. PI3K is composed of a catalytic and a regulatory subunit. The protein encoded by this gene represents a regulatory subunit of PI3K. The encoded protein contains two SH2 domains through which it binds activated protein tyrosine kinases to regulate their activity. [provided by RefSeq, Jun 2016].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 4bp deletion in a coding exon of PIK3R3.
Description 4bp deletion
Parental Cell Line C631
Guide RNA Sequence GCTGAAGTCATTGGCTTAGG
PCR Primer Forward: TGCCCAGCTTAAAATGGTTTACTTT
Reverse: GCATGTTGTCTTTTGAGAGATGTGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.