Online Inquiry
PIK3R2 Knockout Cell Line
SPL-02566
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
185bp insertion |
Target Information | |
---|---|
Target Name | PI3K |
Gene Abbr. | PIK3R2 |
Gene ID | 5296 |
Full Name | phosphoinositide-3-kinase regulatory subunit 2 |
Alias | MPPH, MPPH1, P85B, p85, p85-BETA |
Species | Human |
Genomic Locus | chr19:18160496 |
Transcript | NM_005027 |
WT Expression Level | 30.30 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Phosphatidylinositol 3-kinase (PI3K) is a lipid kinase that phosphorylates phosphatidylinositol and similar compounds, creating second messengers important in growth signaling pathways. PI3K functions as a heterodimer of a regulatory and a catalytic subunit. The protein encoded by this gene is a regulatory component of PI3K. Two transcript variants, one protein coding and the other non-protein coding, have been found for this gene. [provided by RefSeq, Dec 2012]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 185bp insertion in a coding exon of PIK3R2. |
Description | 185bp insertion |
Parental Cell Line | C631 |
Guide RNA Sequence | GCAGTTCTCCCCACCTGATG |
PCR Primer |
Forward: CTAACCCAGAAAATTGTGTCCCATC Reverse: CCTGTCACTAGAGGTAAGCAAGC |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.