Online Inquiry
Pik3r2 cDNA ORF Clone, Rat, N-His tag
SPD-11397
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Rat phosphoinositide-3-kinase, regulatory subunit 2 (beta) with N terminal His tag. |
Target Information | |
---|---|
Species | Rat |
Target Name | PI3K |
Gene Abbr. | Pik3r2 |
Gene ID | 29741 |
Full Name | phosphoinositide-3-kinase regulatory subunit 2 |
Introduction | Phosphoinositide 3-kinase (PI3K) catalyzes the production of phosphatidylinositol-3,4,5-triphosphate by phosphorylating phosphatidylinositol phosphatidylinositol-4-phosphate (PIP), and phosphatidylinositol-4,5-bisphosphate (PIP2). Growth factors and hormones trigger this phosphorylation event, which in turn coordinates cell growth, cell cycle entry, cell migration, and cell survival. PTEN reverses this process, and research studies have shown that the PI3K signaling pathway is constitutively activated in human cancers that have loss of function of PTEN. PI3Ks are composed of a catalytic subunit (p110) and a regulatory subunit. Various isoforms of the catalytic subunit (p110α, p110β, p110γ, and p110δ) have been isolated, and the regulatory subunits that associate with p110α, p110β, and p110δ are p85α and p85β. In contrast, p110γ associates with a p101 regulatory subunit that is unrelated to p85. Furthermore, p110γ is activated by βγ subunits of heterotrimeric G proteins. |
Product Details | |
---|---|
Description | Full length Clone DNA of Rat phosphoinositide-3-kinase, regulatory subunit 2 (beta) with N terminal His tag. |
NCBI Ref Seq | NM_022185.2 |
RefSeq ORF Size | 2169 bp |
Vector | pCMV3-N-His |
Promoter | Enhanced CMV promoter |
Tag Sequence | His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.