PIK3R1 Knockout Cell Line - CD BioSciences

service-banner

PIK3R1 Knockout Cell Line

PIK3R1 Knockout Cell Line

SPL-02565

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name PI3K
Gene Abbr. PIK3R1
Gene ID 5295
Full Name phosphoinositide-3-kinase regulatory subunit 1
Alias AGM7, GRB1, IMD36, p85, p85-ALPHA
Species Human
Genomic Locus chr5:68293405
Transcript NM_181523
WT Expression Level 15.60 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of PIK3R1.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence CTAGAGATTCATTCCGGTAG
PCR Primer Forward: TGGTACGAGATGCGTCTACTAAAAT
Reverse: GGATCTTGTCTAAACATCGTAACTGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.