Online Inquiry
PIK3R1 Knockout Cell Line
SPL-02564
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
23bp deletion |
Target Information | |
---|---|
Target Name | PI3K |
Gene Abbr. | PIK3R1 |
Gene ID | 5295 |
Full Name | phosphoinositide-3-kinase regulatory subunit 1 |
Alias | AGM7, GRB1, IMD36, p85, p85-ALPHA |
Species | Human |
Genomic Locus | chr5:68293405 |
Transcript | NM_181523 |
WT Expression Level | 15.60 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Phosphatidylinositol 3-kinase phosphorylates the inositol ring of phosphatidylinositol at the 3-prime position. The enzyme comprises a 110 kD catalytic subunit and a regulatory subunit of either 85, 55, or 50 kD. This gene encodes the 85 kD regulatory subunit. Phosphatidylinositol 3-kinase plays an important role in the metabolic actions of insulin, and a mutation in this gene has been associated with insulin resistance. Alternative splicing of this gene results in four transcript variants encoding different isoforms. [provided by RefSeq, Jun 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of PIK3R1. |
Description | 23bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | CTAGAGATTCATTCCGGTAG |
PCR Primer |
Forward: TGGTACGAGATGCGTCTACTAAAAT Reverse: GGATCTTGTCTAAACATCGTAACTGG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.