Pik3r1 cDNA ORF Clone, Mouse, N-His tag - CD BioSciences

service-banner

Pik3r1 cDNA ORF Clone, Mouse, N-His tag

Pik3r1 cDNA ORF Clone, Mouse, N-His tag

SPD-11374

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) with N terminal His tag.
Target Information
Species Mouse
Target Name PI3K
Gene Abbr. Pik3r1
Gene ID 18708
Full Name phosphoinositide-3-kinase regulatory subunit 1
Alias PI, PI3K, p50, p50alpha, p55
Introduction Phosphoinositide 3-kinase (PI3K) catalyzes the production of phosphatidylinositol-3,4,5-triphosphate by phosphorylating phosphatidylinositol phosphatidylinositol-4-phosphate (PIP), and phosphatidylinositol-4,5-bisphosphate (PIP2). Growth factors and hormones trigger this phosphorylation event, which in turn coordinates cell growth, cell cycle entry, cell migration, and cell survival. PTEN reverses this process, and research studies have shown that the PI3K signaling pathway is constitutively activated in human cancers that have loss of function of PTEN. PI3Ks are composed of a catalytic subunit (p110) and a regulatory subunit. Various isoforms of the catalytic subunit (p110α, p110β, p110γ, and p110δ) have been isolated, and the regulatory subunits that associate with p110α, p110β, and p110δ are p85α and p85β. In contrast, p110γ associates with a p101 regulatory subunit that is unrelated to p85. Furthermore, p110γ is activated by βγ subunits of heterotrimeric G proteins.
Product Details
Description Full length Clone DNA of Mouse phosphatidylinositol 3-kinase, regulatory subunit, polypeptide 1 (p85 alpha) with N terminal His tag.
NCBI Ref Seq NM_001077495.2
RefSeq ORF Size 2175 bp
Vector pCMV3-N-His
Promoter Enhanced CMV promoter
Tag Sequence His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.