PIK3R1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PIK3R1 cDNA ORF Clone, Human, untagged

PIK3R1 cDNA ORF Clone, Human, untagged

SPD-11378

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 1 (alpha).
Target Information
Species Human
Target Name PI3K
Gene Abbr. PIK3R1
Gene ID 5295
Full Name phosphoinositide-3-kinase regulatory subunit 1
Alias AGM7, GRB1, IMD36, p85, p85-ALPHA
Introduction Phosphoinositide 3-kinase (PI3K) catalyzes the production of phosphatidylinositol-3,4,5-triphosphate by phosphorylating phosphatidylinositol phosphatidylinositol-4-phosphate (PIP), and phosphatidylinositol-4,5-bisphosphate (PIP2). Growth factors and hormones trigger this phosphorylation event, which in turn coordinates cell growth, cell cycle entry, cell migration, and cell survival. PTEN reverses this process, and research studies have shown that the PI3K signaling pathway is constitutively activated in human cancers that have loss of function of PTEN. PI3Ks are composed of a catalytic subunit (p110) and a regulatory subunit. Various isoforms of the catalytic subunit (p110α, p110β, p110γ, and p110δ) have been isolated, and the regulatory subunits that associate with p110α, p110β, and p110δ are p85α and p85β. In contrast, p110γ associates with a p101 regulatory subunit that is unrelated to p85. Furthermore, p110γ is activated by βγ subunits of heterotrimeric G proteins.
Product Details
Description Full length Clone DNA of Human phosphoinositide-3-kinase, regulatory subunit 1 (alpha).
NCBI Ref Seq BC030815
RefSeq ORF Size 1365 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Restriction Sites HindIII + XbaI (6.1kb + 1.37kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.