Online Inquiry
PIK3CA Knockout Cell Line
SPL-02538
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | PI3K |
| Gene Abbr. | PIK3CA |
| Gene ID | 5290 |
| Full Name | phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha |
| Alias | CLAPO, CLOVE, CWS5, MCAP, MCM |
| Species | Human |
| Genomic Locus | chr3:179198835 |
| Transcript | NM_006218 |
| WT Expression Level | 4.01 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PIK3CA. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AGTTCACCTGATGATGGTCG |
| PCR Primer |
Forward: AGCCTAATCAAGTCAAACTATGGAA Reverse: AAGTTGATGGAGGGGGTATTTTCTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.