Online Inquiry
PIK3C3 cDNA ORF Clone, Human, untagged
SPD-11363
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human phosphatidylinositol 3-kinase catalytic subunit type 3 |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PI3K |
| Gene Abbr. | PIK3C3 |
| Gene ID | 5289 |
| Full Name | phosphatidylinositol 3-kinase catalytic subunit type 3 |
| Alias | VPS34, Vps34, hVps34 |
| Introduction | Three distinct types of phosphoinositide 3-kinases (PI3K) have been characterized. Unlike other PI3Ks, PI3K class III catalyzes the phosphorylation of phosphatidylinositol at the D3 position, producing phosphatidylinositol-3-phosphate (PIP3). PI3K class III is the mammalian homolog of Vps34, first identified in yeast. PI3K class III interacts with the regular subunit p150, the mammalian homolog of Vps15, which regulates cellular membrane association through myristoylation. PIP3 recruits several proteins with FYVE or PX domains to membranes regulating vesicular transport and protein sorting. Moreover, PI3K class III has been shown to regulate autophagy, trimeric G-protein signaling, and the mTOR nutrient-sensing pathway.PI3 Kinase Class III/VPS34 is phosphorylated at Ser249 by the autophagy kinase ULK1. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human phosphatidylinositol 3-kinase catalytic subunit type 3 |
| NCBI Ref Seq | NM_002647.3 |
| RefSeq ORF Size | 2664 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | KpnI + XbaI (6.1kb + 2.65kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.