Online Inquiry
PIK3C2B Knockout Cell Line
SPL-02535
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 2bp insertion |
| Target Information | |
|---|---|
| Target Name | PIK3C2B |
| Gene Abbr. | PIK3C2B |
| Gene ID | 5287 |
| Full Name | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 beta |
| Alias | C2-PI3K |
| Species | Human |
| Genomic Locus | chr1:204468901 |
| Transcript | NM_002646 |
| WT Expression Level | 4.47 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | The protein encoded by this gene belongs to the phosphoinositide 3-kinase (PI3K) family. PI3-kinases play roles in signaling pathways involved in cell proliferation, oncogenic transformation, cell survival, cell migration, and intracellular protein trafficking. This protein contains a lipid kinase catalytic domain as well as a C-terminal C2 domain, a characteristic of class II PI3-kinases. C2 domains act as calcium-dependent phospholipid binding motifs that mediate translocation of proteins to membranes, and may also mediate protein-protein interactions. The PI3-kinase activity of this protein is sensitive to low nanomolar levels of the inhibitor wortmanin. The C2 domain of this protein was shown to bind phospholipids but not Ca2+, which suggests that this enzyme may function in a calcium-independent manner. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 2bp insertion in a coding exon of PIK3C2B. |
| Description | 2bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AACCGAAAGAATGCGACGCC |
| PCR Primer |
Forward: GGTCTGTGGACTATGATGGTATCAA Reverse: TAAGGACTTGGCAGAGTTGGATGTA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.