Online Inquiry
PIK3C2A cDNA ORF Clone, Human, untagged
SPD-11362
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PI3K |
| Gene Abbr. | PIK3C2A |
| Gene ID | 5286 |
| Full Name | phosphatidylinositol-4-phosphate 3-kinase catalytic subunit type 2 alpha |
| Alias | CPK, OCSKD, PI3-K-C2(ALPHA), PI3-K-C2A, PI3K-C2-alpha |
| Introduction | Class II phosphatidylinositol 3-kinases (PI3K) contain a C-terminal C2 domain that is unique to the class II isoforms of the PI3K family. This C2 domain mediates protein and phospholipid binding acitivities. PI3K Class II α generates phosphatidylinositol 3-phosphate (PIP3) and phosphatidylinositol 3,4-bisphosphate (PI(3, 4)P2) from phosphatidylinositol and phosphatidylinositol 4-phosphate. PI3K Class II α is located in various intracellular locations such as the trans-Golgi network, endocytic compartments, clathrin-coated vesicles, and nuclear speckles. Research studies have indicated that PI3K Class II α regulates the assembly and distribution of clathrin, resulting in the modulation of clathrin-dependent trafficking and sorting within the trans Golgi network. PI3K Class II α also mediates translocation of the glucose transporter GLUT4 to the plasma membrane in response to insulin. PI3K Class II α has also been shown to regulate neurosecretory granule exocytosis (8) and vascular smooth muscle contraction. Unlike other PI3K family members, PI3K Class II α is less sensitive to the PI3K inhibitors wortmannin and LY294002. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha |
| NCBI Ref Seq | NM_002645.2 |
| RefSeq ORF Size | 5061 bp |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV mammalian cell promoter |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.