PIAS4 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PIAS4 cDNA ORF Clone, Human, untagged

PIAS4 cDNA ORF Clone, Human, untagged

SPD-11466

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human protein inhibitor of activated STAT 4
Target Information
Species Human
Target Name PIAS4
Gene Abbr. PIAS4
Gene ID 51588
Full Name protein inhibitor of activated STAT 4
Alias PIAS-gamma, PIASY, Piasg, ZMIZ6
Introduction The protein inhibitor of activated Stat (PIAS) proteins, which include PIAS1, PIAS3, PIASx, and PIASy, were originally characterized based on their interaction with the Stat family of transcription factors. PIAS1, PIAS3, and PIASx interact with and repress Stat1, Stat3, and Stat4, respectively. Deletion of PIAS1 leads to inhibition of interferon-inducible genes and increased protection against infection. The PIAS family contains a conserved RING domain that has been linked to a function as a small ubiquitin-related modifier (SUMO) ligase, coupling the SUMO conjugating enzyme Ubc9 with its substrate proteins. Numerous studies have now shown that PIAS family members can regulate the activity of transcription factors through distinct mechanisms, including NF-κB, c-Jun, p53, Oct-4 and Smads. The activity of PIAS1 is regulated by both phosphorylation and arginine methylation. Inflammatory stimuli can induce IKK-mediated phosphorylation of PIAS1 at Ser90, which is required for its activity. In addition, PRMT1 induces arginine methylation of PIAS1 at Arg303 following interferon treatment and is associated with its repressive activity on Stat1.PIAS4, also known as PIASy, is a specific SUMO-E3 ligase for Ets-1 and represses Ets-1 dependent transcription. PIAS4 also alters the nuclear localization, reduces the transcriptional activity of C/EBPδ, and enhances cell proliferation and migration.
Product Details
Description Full length Clone DNA of Human protein inhibitor of activated STAT 4
NCBI Ref Seq NM_015897.3
RefSeq ORF Size 1533 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-untagged
Promoter Enhanced CMV mammalian cell promoter
Restriction Sites KpnI + XbaI (6.1kb + 1.53kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.