Online Inquiry
PIAS3 cDNA ORF Clone, Human, untagged
SPD-11464
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human protein inhibitor of activated STAT, 3. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PIAS3 |
| Gene Abbr. | PIAS3 |
| Gene ID | 10401 |
| Full Name | protein inhibitor of activated STAT 3 |
| Alias | ZMIZ5 |
| Introduction | The protein inhibitor of activated Stat (PIAS) proteins, which include PIAS1, PIAS3, PIASx, and PIASy, were originally characterized based on their interaction with the Stat family of transcription factors. PIAS1, PIAS3, and PIASx interact with and repress Stat1, Stat3, and Stat4, respectively. Deletion of PIAS1 leads to inhibition of interferon-inducible genes and increased protection against infection. The PIAS family contains a conserved RING domain that has been linked to a function as a small ubiquitin-related modifier (SUMO) ligase, coupling the SUMO conjugating enzyme Ubc9 with its substrate proteins. Numerous studies have now shown that PIAS family members can regulate the activity of transcription factors through distinct mechanisms, including NF-κB, c-Jun, p53, Oct-4 and Smads. The activity of PIAS1 is regulated by both phosphorylation and arginine methylation. Inflammatory stimuli can induce IKK-mediated phosphorylation of PIAS1 at Ser90, which is required for its activity. In addition, PRMT1 induces arginine methylation of PIAS1 at Arg303 following interferon treatment and is associated with its repressive activity on Stat1. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human protein inhibitor of activated STAT, 3. |
| NCBI Ref Seq | BC001154 |
| RefSeq ORF Size | 1887 bp |
| Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
| Vector | pCMV3-untagged |
| Promoter | Enhanced CMV promoter |
| Restriction Sites | HindIII + XbaI (6.1kb + 1.89kb) |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Ampicillin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.