Online Inquiry
PI4K2A Knockout Cell Line
SPL-02528
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
7bp deletion |
Target Information | |
---|---|
Target Name | PI4K2A |
Gene Abbr. | PI4K2A |
Gene ID | 55361 |
Full Name | phosphatidylinositol 4-kinase type 2 alpha |
Alias | PI4KII, PIK42A |
Species | Human |
Genomic Locus | chr10:97651049 |
Transcript | NM_018425 |
WT Expression Level | 12.41 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of PI4K2A. |
Description | 7bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GACTGCCTTGTCCTTAACCA |
PCR Primer |
Forward: GGCTATTTTGGTCAACTCGGATTTA Reverse: ACTTAGGGTATAAATGACCCCACTG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.