PI4K2A Knockout Cell Line - CD BioSciences

service-banner

PI4K2A Knockout Cell Line

PI4K2A Knockout Cell Line

SPL-02528

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name PI4K2A
Gene Abbr. PI4K2A
Gene ID 55361
Full Name phosphatidylinositol 4-kinase type 2 alpha
Alias PI4KII, PIK42A
Species Human
Genomic Locus chr10:97651049
Transcript NM_018425
WT Expression Level 12.41 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Phosphatidylinositolpolyphosphates (PtdInsPs) are centrally involved in many biologic processes, ranging from cell growth and organization of the actin cytoskeleton to endo- and exocytosis. PI4KII phosphorylates PtdIns at the D-4 position, an essential step in the biosynthesis of PtdInsPs (Barylko et al., 2001 [PubMed 11244087]).[supplied by OMIM, Mar 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of PI4K2A.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GACTGCCTTGTCCTTAACCA
PCR Primer Forward: GGCTATTTTGGTCAACTCGGATTTA
Reverse: ACTTAGGGTATAAATGACCCCACTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.