Online Inquiry
PHKG2 Knockout Cell Line
SPL-02521
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 1bp insertion |
| Target Information | |
|---|---|
| Target Name | PHKG2 |
| Gene Abbr. | PHKG2 |
| Gene ID | 5261 |
| Full Name | phosphorylase kinase catalytic subunit gamma 2 |
| Alias | GSD9C |
| Species | Human |
| Genomic Locus | chr16:30751154 |
| Transcript | NM_000294 |
| WT Expression Level | 27.91 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, encoded by two different genes. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, and the hepatic isoform is encoded by this gene. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9C, also known as autosomal liver glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Feb 2010]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PHKG2. |
| Description | 1bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TAATCTTCACCGCAAACTCG |
| PCR Primer |
Forward: GACTTGTGCTATTTTCCGGCTCTT Reverse: CAAGGAAGACAGCCTCACTGAT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.