PHKG1 Knockout Cell Line - CD BioSciences

service-banner

PHKG1 Knockout Cell Line

PHKG1 Knockout Cell Line

SPL-02520

Size Price
1 Unit Online Inquiry
Description
7bp deletion
Target Information
Target Name PHKG1
Gene Abbr. PHKG1
Gene ID 5260
Full Name phosphorylase kinase catalytic subunit gamma 1
Alias PHKG
Species Human
Genomic Locus chr7:56087693
Transcript NM_006213
WT Expression Level 0.58 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene is a member of the Ser/Thr protein kinase family and encodes a protein with one protein kinase domain and two calmodulin-binding domains. This protein is the catalytic member of a 16 subunit protein kinase complex which contains equimolar ratios of 4 subunit types. The complex is a crucial glycogenolytic regulatory enzyme. This gene has two pseudogenes at chromosome 7q11.21 and one at chromosome 11p11.12. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 7bp deletion in a coding exon of PHKG1.
Description 7bp deletion
Parental Cell Line C631
Guide RNA Sequence GTCATCGACGTCACCGGTGG
PCR Primer Forward: TTGAGCCTGGGTGGTTCTAGTT
Reverse: AAGTGTAAATCTCTGTCAAGGGCAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.