PHF6 Knockout Cell Line - CD BioSciences

service-banner

PHF6 Knockout Cell Line

PHF6 Knockout Cell Line

SPL-02513

Size Price
1 Unit Online Inquiry
Description
1bp insertion
Target Information
Target Name PHF6
Gene Abbr. PHF6
Gene ID 84295
Full Name PHD finger protein 6
Alias BFLS, BORJ, CENP-31
Species Human
Genomic Locus chrX:134377728
Transcript NM_001015877
WT Expression Level 59.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms. [provided by RefSeq, Jun 2010].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 1bp insertion in a coding exon of PHF6.
Description 1bp insertion
Parental Cell Line C631
Guide RNA Sequence TATGGTGCGCTGCCACCTTC
PCR Primer Forward: GAGACTTAAAGTGGCATTCTAAAGG
Reverse: TCTAGTAAAAATGGCATAGCATTAGTGA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.