Online Inquiry
PHF6 Knockout Cell Line
SPL-02512
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
1bp deletion |
Target Information | |
---|---|
Target Name | PHF6 |
Gene Abbr. | PHF6 |
Gene ID | 84295 |
Full Name | PHD finger protein 6 |
Alias | BFLS, BORJ, CENP-31 |
Species | Human |
Genomic Locus | chrX:134393525 |
Transcript | NM_001015877 |
WT Expression Level | 59.10 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene is a member of the plant homeodomain (PHD)-like finger (PHF) family. It encodes a protein with two PHD-type zinc finger domains, indicating a potential role in transcriptional regulation, that localizes to the nucleolus. Mutations affecting the coding region of this gene or the splicing of the transcript have been associated with Borjeson-Forssman-Lehmann syndrome (BFLS), a disorder characterized by mental retardation, epilepsy, hypogonadism, hypometabolism, obesity, swelling of subcutaneous tissue of the face, narrow palpebral fissures, and large ears. Alternate splicing results in multiple transcript variants, encoding different isoforms. [provided by RefSeq, Jun 2010]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 1bp deletion in a coding exon of PHF6. |
Description | 1bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | TCACAACCAATTGTTGCTCC |
PCR Primer |
Forward: TCCGGTTATTCTAAGGAGAGAAAACA Reverse: TGATGATGAAATGCTTTGAAATGGGA |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.