Online Inquiry
PGF Knockout Cell Line
SPL-02507
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 10bp deletion |
| Target Information | |
|---|---|
| Target Name | PGF |
| Gene Abbr. | PGF |
| Gene ID | 5228 |
| Full Name | placental growth factor |
| Alias | D12S1900, PGFL, PIGF, PLGF, PlGF-2 |
| Species | Human |
| Genomic Locus | chr14:74949467 |
| Transcript | NM_001207012 |
| WT Expression Level | 1.89 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a growth factor found in placenta which is homologous to vascular endothelial growth factor. Alternatively spliced transcripts encoding different isoforms have been found for this gene.[provided by RefSeq, Jun 2011]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 10bp deletion in a coding exon of PGF. |
| Description | 10bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GTCCGAGTACCCCAGCGAGG |
| PCR Primer |
Forward: GGTACCTTCTAGTGGGCAGATTC Reverse: TCACATTAGGAGTTCAGAGTTGAGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.