Online Inquiry
Pfn1 cDNA ORF Clone, Rat, C-Myc tag
SPD-11874
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Rat profilin 1 with C terminal Myc tag. |
| Target Information | |
|---|---|
| Species | Rat |
| Target Name | Profilin-1 |
| Gene Abbr. | Pfn1 |
| Gene ID | 64303 |
| Full Name | profilin 1 |
| Introduction | The dynamic polymerization and depolymerization of actin filaments, a process governed by external and internal signaling events, is vital for cell motility (immune cell function, migration, invasion, metastasis, angiogenesis), cell division and adhesion. Among the many regulators of actin dynamics are profilins. Profilins are conserved actin binding proteins that affect the rate of actin polymerization by binding actin monomers and promoting the exchange of ADP for ATP. Profilins bind to proteins involved in the regulation of actin dynamics including palladin, dynamin-1, VASP and N-WASP. In mice, knockout of the ubiquitously expressed profilin-1 indicates that the protein is essential for embryonic development. Profilin-2 is primarily expressed in brain and functions in the regulation of neurite outgrowth, membrane trafficking and endocytosis. The recently cloned profilin-3 is expressed in kidney and testes. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Rat profilin 1 with C terminal Myc tag. |
| NCBI Ref Seq | NM_022511.2 |
| RefSeq ORF Size | 423 bp |
| Vector | pCMV3-C-Myc |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.