PFN1 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

PFN1 cDNA ORF Clone, Human, C-Myc tag

PFN1 cDNA ORF Clone, Human, C-Myc tag

SPD-11894

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human profilin 1 with C terminal Myc tag.
Target Information
Species Human
Target Name Profilin-1
Gene Abbr. PFN1
Gene ID 5216
Full Name profilin 1
Alias ALS18
Introduction The dynamic polymerization and depolymerization of actin filaments, a process governed by external and internal signaling events, is vital for cell motility (immune cell function, migration, invasion, metastasis, angiogenesis), cell division and adhesion. Among the many regulators of actin dynamics are profilins. Profilins are conserved actin binding proteins that affect the rate of actin polymerization by binding actin monomers and promoting the exchange of ADP for ATP. Profilins bind to proteins involved in the regulation of actin dynamics including palladin, dynamin-1, VASP and N-WASP. In mice, knockout of the ubiquitously expressed profilin-1 indicates that the protein is essential for embryonic development. Profilin-2 is primarily expressed in brain and functions in the regulation of neurite outgrowth, membrane trafficking and endocytosis. The recently cloned profilin-3 is expressed in kidney and testes.
Product Details
Description Full length Clone DNA of Human profilin 1 with C terminal Myc tag.
NCBI Ref Seq BC002475
RefSeq ORF Size 423 bp
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.