Online Inquiry
PFKFB3 cDNA ORF Clone, Human, N-HA tag
SPD-11350
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| Full length Clone DNA of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with N terminal HA tag. |
| Target Information | |
|---|---|
| Species | Human |
| Target Name | PFKFB3 |
| Gene Abbr. | PFKFB3 |
| Gene ID | 5209 |
| Full Name | 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 |
| Alias | IPFK2, PFK2, iPFK-2 |
| Introduction | The bifunctional 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFK/FBPase or PFKFB) catalyzes the synthesis and degradation of fructose 2,6-bisphosphate and regulates its steady-state level. Fructose 2,6-bisphosphate activates phosphofructokinase, a rate-limiting enzyme in glycolysis, by allosteric regulation. Four different PFKFB isoforms (PFKFB1, PFKFB2, PFKFB3, and PFKFB4) have been identified. One of them, PFKFB3/iPFK-2, was shown to be inducible by hypoxia leading to increased glycolysis under hypoxic conditions. Research studies have shown that PFKFB3/iPFK-2 is also highly expressed in some types of human cancer. |
| Product Details | |
|---|---|
| Description | Full length Clone DNA of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with N terminal HA tag. |
| NCBI Ref Seq | BC040482 |
| RefSeq ORF Size | 1563 bp |
| Vector | pCMV3-N-HA |
| Promoter | Enhanced CMV promoter |
| Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
| Quality Control | The plasmid is confirmed by full-length sequencing. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
| Usage | |
|---|---|
| Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
| Antibiotic in E.coli | Kanamycin |
| Antibiotic in Mammalian cell | Hygromycin |
| Application | Stable or Transient mammalian expression |
| Shipping | Each tube contains lyophilized plasmid. |
| Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.