PFKFB3 cDNA ORF Clone, Human, C-FLAG tag - CD BioSciences

service-banner

PFKFB3 cDNA ORF Clone, Human, C-FLAG tag

PFKFB3 cDNA ORF Clone, Human, C-FLAG tag

SPD-11342

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with C terminal Flag tag.
Target Information
Species Human
Target Name PFKFB3
Gene Abbr. PFKFB3
Gene ID 5209
Full Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3
Alias IPFK2, PFK2, iPFK-2
Introduction The bifunctional 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (PFK/FBPase or PFKFB) catalyzes the synthesis and degradation of fructose 2,6-bisphosphate and regulates its steady-state level. Fructose 2,6-bisphosphate activates phosphofructokinase, a rate-limiting enzyme in glycolysis, by allosteric regulation. Four different PFKFB isoforms (PFKFB1, PFKFB2, PFKFB3, and PFKFB4) have been identified. One of them, PFKFB3/iPFK-2, was shown to be inducible by hypoxia leading to increased glycolysis under hypoxic conditions. Research studies have shown that PFKFB3/iPFK-2 is also highly expressed in some types of human cancer.
Product Details
Description Full length Clone DNA of Human 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 3 with C terminal Flag tag.
NCBI Ref Seq BC040482
RefSeq ORF Size 1563 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Restriction Sites KpnI + XbaI (6kb + 1.6kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.