Pea15a cDNA ORF Clone, Mouse, C-FLAG tag - CD BioSciences

service-banner

Pea15a cDNA ORF Clone, Mouse, C-FLAG tag

Pea15a cDNA ORF Clone, Mouse, C-FLAG tag

SPD-11312

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Mouse phosphoprotein enriched in astrocytes 15A with C terminal Flag tag.
Target Information
Species Mouse
Target Name PEA-15
Gene Abbr. Pea15a
Gene ID 18611
Full Name phosphoprotein enriched in astrocytes 15A
Alias Mat, Mat1, PEA-, PEA-15, Pea
Introduction PEA-15 is a 15 kDa phosphoprotein expressed abundantly in astrocytes and fibroblasts as well as in tissues, including the lung and eye. The protein has been shown to coordinate cell growth, death, and glucose utilization. The amino-terminal DED domain of PEA-15 mediates its binding to FADD or Erk and further regulates the Erk and apoptosis signaling pathways. PEA-15 can be phosphorylated at two serine residues, Ser104 and Ser116, located within the carboxy terminus. Phosphorylation at these sites regulates binding to Erk and FADD.
Product Details
Description Full length Clone DNA of Mouse phosphoprotein enriched in astrocytes 15A with C terminal Flag tag.
NCBI Ref Seq NM_011063.2
RefSeq ORF Size 393 bp
Vector pCMV3-C-FLAG
Promoter Enhanced CMV promoter
Tag Sequence FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.