Online Inquiry
PEA15 cDNA ORF Clone, Human, C-HA tag
SPD-11305
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human phosphoprotein enriched in astrocytes 15 with C terminal HA tag. |
Target Information | |
---|---|
Species | Human |
Target Name | PEA-15 |
Gene Abbr. | PEA15 |
Gene ID | 8682 |
Full Name | proliferation and apoptosis adaptor protein 15 |
Alias | HMAT1, HUMMAT1H, MAT1, MAT1H, PEA-15 |
Introduction | PEA-15 is a 15 kDa phosphoprotein expressed abundantly in astrocytes and fibroblasts as well as in tissues, including the lung and eye. The protein has been shown to coordinate cell growth, death, and glucose utilization. The amino-terminal DED domain of PEA-15 mediates its binding to FADD or Erk and further regulates the Erk and apoptosis signaling pathways. PEA-15 can be phosphorylated at two serine residues, Ser104 and Ser116, located within the carboxy terminus. Phosphorylation at these sites regulates binding to Erk and FADD. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human phosphoprotein enriched in astrocytes 15 with C terminal HA tag. |
NCBI Ref Seq | NM_003768.3 |
RefSeq ORF Size | 435 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-HA |
Promoter | Enhanced CMV promoter |
Tag Sequence | HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC |
Restriction Sites | HindIII + NotI (6kb + 0.44kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.