PDPK1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PDPK1 cDNA ORF Clone, Human, untagged

PDPK1 cDNA ORF Clone, Human, untagged

SPD-11300

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human 3-phosphoinositide dependent protein kinase-1.
Target Information
Species Human
Target Name PDK1
Gene Abbr. PDPK1
Gene ID 5170
Full Name 3-phosphoinositide dependent protein kinase 1
Alias PDK1, PDPK2, PDPK2P, PRO0461
Introduction Phosphoinositide-dependent protein kinase 1 (PDK1) plays a central role in many signal transduction pathways including the activation of Akt and the PKC isoenzymes p70 S6 kinase and RSK. Through its effects on these kinases, PDK1 is involved in the regulation of a wide variety of processes, including cell proliferation, differentiation and apoptosis.
Product Details
Description Full length Clone DNA of Human 3-phosphoinositide dependent protein kinase-1.
NCBI Ref Seq NM_002613.3
RefSeq ORF Size 1671 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.