Online Inquiry
PDK1 Knockout Cell Line
SPL-02497
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
20bp deletion |
Target Information | |
---|---|
Target Name | PDHK1 |
Gene Abbr. | PDK1 |
Gene ID | 5163 |
Full Name | pyruvate dehydrogenase kinase 1 |
Species | Human |
Genomic Locus | chr2:172556285 |
Transcript | NM_002610 |
WT Expression Level | 17.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of PDK1. |
Description | 20bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | AGCGCGCGTAGAAGTCCACC |
PCR Primer |
Forward: TGTAAAACGACGGCCAGAGGAAGGTGGGATTTGTTTCAAAAG Reverse: GAGGGAGGAAGGAAGCACCTAAG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.