PDK1 Knockout Cell Line - CD BioSciences

service-banner

PDK1 Knockout Cell Line

PDK1 Knockout Cell Line

SPL-02497

Size Price
1 Unit Online Inquiry
Description
20bp deletion
Target Information
Target Name PDHK1
Gene Abbr. PDK1
Gene ID 5163
Full Name pyruvate dehydrogenase kinase 1
Species Human
Genomic Locus chr2:172556285
Transcript NM_002610
WT Expression Level 17.54 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of PDK1.
Description 20bp deletion
Parental Cell Line C631
Guide RNA Sequence AGCGCGCGTAGAAGTCCACC
PCR Primer Forward: TGTAAAACGACGGCCAGAGGAAGGTGGGATTTGTTTCAAAAG
Reverse: GAGGGAGGAAGGAAGCACCTAAG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.