PDK1 cDNA ORF Clone, Human, untagged - CD BioSciences

service-banner

PDK1 cDNA ORF Clone, Human, untagged

PDK1 cDNA ORF Clone, Human, untagged

SPD-11280

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human pyruvate dehydrogenase kinase, isozyme 1.
Target Information
Species Human
Target Name PDHK1
Gene Abbr. PDK1
Gene ID 5163
Full Name pyruvate dehydrogenase kinase 1
Introduction Pyruvate generated from glycolysis is converted to acetyl-CoA by pyruvate dehydrogenase (PDH) under normoxia. This is a critical link between glycolysis and the TCA cycle. PDH activity is regulated by phosphorylation and dephosphorylation. Pyruvate dehydrogenase kinase (PDHK) phosphorylates PDH and inactivates it, whereas dephosphorylation of PDH is carried out by pyruvate dehydrogenase phosphatase to generate the active form. Hypoxia can directly induce pyruvate dehydrogenase kinase 1 (PDHK1) expression, which results in inactivation of PDH and the TCA cycle and subsequent suppression of metabolism.
Product Details
Description Full length Clone DNA of Human pyruvate dehydrogenase kinase, isozyme 1.
NCBI Ref Seq BC039158
RefSeq ORF Size 1311 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.