Online Inquiry
PDK1 cDNA ORF Clone, Human, C-Myc tag
SPD-11273
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Human pyruvate dehydrogenase kinase, isozyme 1 with C terminal Myc tag. |
Target Information | |
---|---|
Species | Human |
Target Name | PDHK1 |
Gene Abbr. | PDK1 |
Gene ID | 5163 |
Full Name | pyruvate dehydrogenase kinase 1 |
Introduction | Pyruvate generated from glycolysis is converted to acetyl-CoA by pyruvate dehydrogenase (PDH) under normoxia. This is a critical link between glycolysis and the TCA cycle. PDH activity is regulated by phosphorylation and dephosphorylation. Pyruvate dehydrogenase kinase (PDHK) phosphorylates PDH and inactivates it, whereas dephosphorylation of PDH is carried out by pyruvate dehydrogenase phosphatase to generate the active form. Hypoxia can directly induce pyruvate dehydrogenase kinase 1 (PDHK1) expression, which results in inactivation of PDH and the TCA cycle and subsequent suppression of metabolism. |
Product Details | |
---|---|
Description | Full length Clone DNA of Human pyruvate dehydrogenase kinase, isozyme 1 with C terminal Myc tag. |
NCBI Ref Seq | BC039158 |
RefSeq ORF Size | 1311 bp |
Sequence Information | Identical with the Gene Bank Ref. ID sequence. |
Vector | pCMV3-C-Myc |
Promoter | Enhanced CMV promoter |
Tag Sequence | Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG |
Restriction Sites | KpnI + XbaI (6kb + 1.36kb) |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.