Online Inquiry
PDGFRA Knockout Cell Line
SPL-02494
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 176bp insertion |
| Target Information | |
|---|---|
| Target Name | PDGF Receptor |
| Gene Abbr. | PDGFRA |
| Gene ID | 5156 |
| Full Name | platelet derived growth factor receptor alpha |
| Alias | CD140A, PDGFR-2, PDGFR2 |
| Species | Human |
| Genomic Locus | chr4:54258787 |
| Transcript | NM_006206 |
| WT Expression Level | 1.09 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a cell surface tyrosine kinase receptor for members of the platelet-derived growth factor family. These growth factors are mitogens for cells of mesenchymal origin. The identity of the growth factor bound to a receptor monomer determines whether the functional receptor is a homodimer or a heterodimer, composed of both platelet-derived growth factor receptor alpha and beta polypeptides. Studies suggest that this gene plays a role in organ development, wound healing, and tumor progression. Mutations in this gene have been associated with idiopathic hypereosinophilic syndrome, somatic and familial gastrointestinal stromal tumors, and a variety of other cancers. [provided by RefSeq, Mar 2012]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 176bp insertion in a coding exon of PDGFRA. |
| Description | 176bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | CAGCCTAAGACCAGGAACGC |
| PCR Primer |
Forward: TGTAAAACGACGGCCAGTCAGAAGGTTTTGGCTTCAGG Reverse: AACTGCCACTGGAGAGCATT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.