Online Inquiry
PDE7A Knockout Cell Line
SPL-02489
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
20bp deletion |
Target Information | |
---|---|
Target Name | PDE7A |
Gene Abbr. | PDE7A |
Gene ID | 5150 |
Full Name | phosphodiesterase 7A |
Alias | HCP1, PDE7 |
Species | Human |
Genomic Locus | chr8:65747723 |
Transcript | NM_001242318 |
WT Expression Level | 13.13 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 20bp deletion in a coding exon of PDE7A. |
Description | 20bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GTGAAGATCTAAGATATCGC |
PCR Primer |
Forward: AAAACCTGGAAAATAGGCTCAACTG Reverse: AGTGGTATTGCAAAGATAGCATGTG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.