PDE6D cDNA ORF Clone, Rhesus, untagged - CD BioSciences

service-banner

PDE6D cDNA ORF Clone, Rhesus, untagged

PDE6D cDNA ORF Clone, Rhesus, untagged

SPD-11268

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Rhesus phosphodiesterase 6D, cGMP-specific, rod, delta.
Target Information
Species Rhesus
Target Name PDE6D
Gene Abbr. PDE6D
Gene ID 712629
Full Name phosphodiesterase 6D
Product Details
Description Full length Clone DNA of Rhesus phosphodiesterase 6D, cGMP-specific, rod, delta.
NCBI Ref Seq NM_001194606.1
RefSeq ORF Size 453 bp
Vector pCMV3-untagged
Promoter Enhanced CMV promoter
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Ampicillin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.