Online Inquiry
PDE10A Knockout Cell Line
SPL-02484
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
23bp deletion |
Target Information | |
---|---|
Target Name | PDE10A |
Gene Abbr. | PDE10A |
Gene ID | 10846 |
Full Name | phosphodiesterase 10A |
Alias | ADSD2, HSPDE10A, IOLOD, LINC00473, PDE10A19 |
Species | Human |
Genomic Locus | chr6:165543505 |
Transcript | NM_001130690 |
WT Expression Level | 0.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 23bp deletion in a coding exon of PDE10A. |
Description | 23bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | ACAAATTCATCTAATACCTG |
PCR Primer |
Forward: AATGCTTAGTCTTTTGCCGTAAGAT Reverse: CTGGGTCTTAGCATAATGTGTTGTG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.