PDE10A Knockout Cell Line - CD BioSciences

service-banner

PDE10A Knockout Cell Line

PDE10A Knockout Cell Line

SPL-02483

Size Price
1 Unit Online Inquiry
Description
13bp deletion
Target Information
Target Name PDE10A
Gene Abbr. PDE10A
Gene ID 10846
Full Name phosphodiesterase 10A
Alias ADSD2, HSPDE10A, IOLOD, LINC00473, PDE10A19
Species Human
Genomic Locus chr6:165543505
Transcript NM_001130690
WT Expression Level 0.18 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase family. It plays a role in signal transduction by regulating the intracellular concentration of cyclic nucleotides. This protein can hydrolyze both cAMP and cGMP to the corresponding nucleoside 5' monophosphate, but has higher affinity for cAMP, and is more efficient with cAMP as substrate. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, Dec 2011].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 13bp deletion in a coding exon of PDE10A.
Description 13bp deletion
Parental Cell Line C631
Guide RNA Sequence ACAAATTCATCTAATACCTG
PCR Primer Forward: AATGCTTAGTCTTTTGCCGTAAGAT
Reverse: CTGGGTCTTAGCATAATGTGTTGTG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.