Online Inquiry
Pdcd4 cDNA ORF Clone, Mouse, N-FLAG tag
SPD-11233
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
Full length Clone DNA of Mouse programmed cell death 4 with N terminal Flag tag. |
Target Information | |
---|---|
Species | Mouse |
Target Name | PDCD4 |
Gene Abbr. | Pdcd4 |
Gene ID | 18569 |
Full Name | programmed cell death 4 |
Alias | D19Ucl, D19Ucla1, MA-, Ma3, T |
Introduction | Programmed cell death 4 (Pdcd4) is a novel tumor suppressor. Pdcd4 directly inhibits the helicase activity of eukaryotic translation initiation factor 4A (eIF4A), a component of the translation initiation complex. Pdcd4 also suppresses the transactivation of activator protein-1 (AP-1)-responsive promoters by c-Jun. Pdcd4 contains two Akt phosphorylation sites, one at Ser67 and the other at Ser457. The phosphorylation of Pdcd4 by Akt causes nuclear translocation of Pdcd4 and a significant decrease in the ability of Pdcd4 to interfere with the transactivation of AP-1 responsive promoters by c-Jun. |
Product Details | |
---|---|
Description | Full length Clone DNA of Mouse programmed cell death 4 with N terminal Flag tag. |
NCBI Ref Seq | NM_001168492.1 |
RefSeq ORF Size | 1410 bp |
Vector | pCMV3-N-FLAG |
Promoter | Enhanced CMV promoter |
Tag Sequence | FLAG Tag Sequence: GATTACAAGGATGACGACGATAAG |
Quality Control | The plasmid is confirmed by full-length sequencing. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
Usage | |
---|---|
Sequencing Primers | T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG); |
Antibiotic in E.coli | Kanamycin |
Antibiotic in Mammalian cell | Hygromycin |
Application | Stable or Transient mammalian expression |
Shipping | Each tube contains lyophilized plasmid. |
Storage | The lyophilized plasmid can be stored at ambient temperature for three months. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.