PDCD4 cDNA ORF Clone, Human, C-Myc tag - CD BioSciences

service-banner

PDCD4 cDNA ORF Clone, Human, C-Myc tag

PDCD4 cDNA ORF Clone, Human, C-Myc tag

SPD-11240

Size Price
1 Unit Online Inquiry
Description
Full length Clone DNA of Human programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1 with C terminal Myc tag.
Target Information
Species Human
Target Name PDCD4
Gene Abbr. PDCD4
Gene ID 27250
Full Name programmed cell death 4
Alias H731
Introduction Programmed cell death 4 (Pdcd4) is a novel tumor suppressor. Pdcd4 directly inhibits the helicase activity of eukaryotic translation initiation factor 4A (eIF4A), a component of the translation initiation complex. Pdcd4 also suppresses the transactivation of activator protein-1 (AP-1)-responsive promoters by c-Jun. Pdcd4 contains two Akt phosphorylation sites, one at Ser67 and the other at Ser457. The phosphorylation of Pdcd4 by Akt causes nuclear translocation of Pdcd4 and a significant decrease in the ability of Pdcd4 to interfere with the transactivation of AP-1 responsive promoters by c-Jun.
Product Details
Description Full length Clone DNA of Human programmed cell death 4 (neoplastic transformation inhibitor), transcript variant 1 with C terminal Myc tag.
NCBI Ref Seq NM_014456.3
RefSeq ORF Size 1455 bp
Sequence Information Identical with the Gene Bank Ref. ID sequence.
Vector pCMV3-C-Myc
Promoter Enhanced CMV promoter
Tag Sequence Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Restriction Sites KpnI + XbaI (6kb + 1.46kb)
Quality Control The plasmid is confirmed by full-length sequencing.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.
Usage
Sequencing Primers T7 (TAATACGACTCACTATAGGG); BGH (TAGAAGGCACAGTCGAGG);
Antibiotic in E.coli Kanamycin
Antibiotic in Mammalian cell Hygromycin
Application Stable or Transient mammalian expression
Shipping Each tube contains lyophilized plasmid.
Storage The lyophilized plasmid can be stored at ambient temperature for three months.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.