Online Inquiry
PDCD10 Knockout Cell Line
SPL-02480
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | PDCD10 |
| Gene Abbr. | PDCD10 |
| Gene ID | 11235 |
| Full Name | programmed cell death 10 |
| Alias | CCM3, TFAR15 |
| Species | Human |
| Genomic Locus | chr3:167704848 |
| Transcript | NM_145860 |
| WT Expression Level | 114.98 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes an evolutionarily conserved protein associated with cell apoptosis. The protein interacts with the serine/threonine protein kinase MST4 to modulate the extracellular signal-regulated kinase (ERK) pathway. It also interacts with and is phosphoryated by serine/threonine kinase 25, and is thought to function in a signaling pathway essential for vascular developent. Mutations in this gene are one cause of cerebral cavernous malformations, which are vascular malformations that cause seizures and cerebral hemorrhages. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PDCD10. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | GAAAGCGGCTCTCAGTGTCT |
| PCR Primer |
Forward: ACTCAGTTTCAAAAGCACAAAGTGA Reverse: TGTTCATGTGATTGCTACAGAATGG |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.