PDCD10 Knockout Cell Line - CD BioSciences

service-banner

PDCD10 Knockout Cell Line

PDCD10 Knockout Cell Line

SPL-02480

Size Price
1 Unit Online Inquiry
Description
8bp deletion
Target Information
Target Name PDCD10
Gene Abbr. PDCD10
Gene ID 11235
Full Name programmed cell death 10
Alias CCM3, TFAR15
Species Human
Genomic Locus chr3:167704848
Transcript NM_145860
WT Expression Level 114.98 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes an evolutionarily conserved protein associated with cell apoptosis. The protein interacts with the serine/threonine protein kinase MST4 to modulate the extracellular signal-regulated kinase (ERK) pathway. It also interacts with and is phosphoryated by serine/threonine kinase 25, and is thought to function in a signaling pathway essential for vascular developent. Mutations in this gene are one cause of cerebral cavernous malformations, which are vascular malformations that cause seizures and cerebral hemorrhages. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jul 2008].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PDCD10.
Description 8bp deletion
Parental Cell Line C631
Guide RNA Sequence GAAAGCGGCTCTCAGTGTCT
PCR Primer Forward: ACTCAGTTTCAAAAGCACAAAGTGA
Reverse: TGTTCATGTGATTGCTACAGAATGG
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.