Online Inquiry
PBK Knockout Cell Line
SPL-02471
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 8bp deletion |
| Target Information | |
|---|---|
| Target Name | PBK |
| Gene Abbr. | PBK |
| Gene ID | 55872 |
| Full Name | PDZ binding kinase |
| Alias | CT84, HEL164, Nori-3, SPK, TOPK |
| Species | Human |
| Genomic Locus | chr8:27828143 |
| Transcript | NM_018492 |
| WT Expression Level | 135.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes a serine/threonine protein kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family. Evidence suggests that mitotic phosphorylation is required for its catalytic activity. The encoded protein may be involved in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis. Overexpression of this gene has been implicated in tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 8bp deletion in a coding exon of PBK. |
| Description | 8bp deletion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | AAGCTTCTGCATAAACGGAG |
| PCR Primer |
Forward: CCAAAAGTAGGCTTGGTCAAAAGAT Reverse: AGGAGCAGACAACCGAATCTAAATA |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.