PBK Knockout Cell Line - CD BioSciences

service-banner

PBK Knockout Cell Line

PBK Knockout Cell Line

SPL-02468

Size Price
1 Unit Online Inquiry
Description
25bp deletion
Target Information
Target Name PBK
Gene Abbr. PBK
Gene ID 55872
Full Name PDZ binding kinase
Alias CT84, HEL164, Nori-3, SPK, TOPK
Species Human
Genomic Locus chr8:27828143
Transcript NM_018492
WT Expression Level 135.25 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing)
Introduction This gene encodes a serine/threonine protein kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family. Evidence suggests that mitotic phosphorylation is required for its catalytic activity. The encoded protein may be involved in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis. Overexpression of this gene has been implicated in tumorigenesis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013].
Product Details
Cell Line Model HAP1
Genotype HAP1 cell line, edited by CRISPR/Cas to contain a 25bp deletion in a coding exon of PBK.
Description 25bp deletion
Parental Cell Line C631
Guide RNA Sequence AAGCTTCTGCATAAACGGAG
PCR Primer Forward: CCAAAAGTAGGCTTGGTCAAAAGAT
Reverse: AGGAGCAGACAACCGAATCTAAATA
Handling Specifications
Revival Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish.
Culture Medium IMDM + 10% FCS
Growth Properties Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20.
Freeze Medium IMDM + 20% FCS + 10% DMSO
Biosafety Level BSL-1
Disclaimer This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations.

For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.