Online Inquiry
PASK Knockout Cell Line
SPL-02465
Size | Price |
1 Unit | Online Inquiry |
Description |
---|
28bp deletion |
Target Information | |
---|---|
Target Name | PASK |
Gene Abbr. | PASK |
Gene ID | 23178 |
Full Name | PAS domain containing serine/threonine kinase |
Alias | PASKIN, STK37 |
Species | Human |
Genomic Locus | chr2:241138773 |
Transcript | NM_015148 |
WT Expression Level | 21.83 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
Introduction | This gene encodes a member of the serine/threonine kinase family that contains two PAS domains. Expression of this gene is regulated by glucose, and the encoded protein plays a role in the regulation of insulin gene expression. Downregulation of this gene may play a role in type 2 diabetes. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Nov 2011]. |
Product Details | |
---|---|
Cell Line Model | HAP1 |
Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 28bp deletion in a coding exon of PASK. |
Description | 28bp deletion |
Parental Cell Line | C631 |
Guide RNA Sequence | GGACATCATCAGCCGTAGTG |
PCR Primer |
Forward: CTTTCTTCCCAAAGGAATGAGACAG Reverse: CATACTGGTCTTTTGGGTTCATGG |
Handling Specifications | |
---|---|
Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
Culture Medium | IMDM + 10% FCS |
Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
Freeze Medium | IMDM + 20% FCS + 10% DMSO |
Biosafety Level | BSL-1 |
Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.