Online Inquiry
PARP4 Knockout Cell Line
SPL-02458
| Size | Price |
| 1 Unit | Online Inquiry |
| Description |
|---|
| 7bp insertion |
| Target Information | |
|---|---|
| Target Name | PARP4 |
| Gene Abbr. | PARP4 |
| Gene ID | 143 |
| Full Name | poly(ADP-ribose) polymerase family member 4 |
| Alias | ADPRTL1, ARTD4, PARP-4, PARPL, PH5P |
| Species | Human |
| Genomic Locus | chr13:24498179 |
| Transcript | NM_006437 |
| WT Expression Level | 19.65 TPM (TPM = Transcripts per million; any value less than 3 is considered non-expressing) |
| Introduction | This gene encodes poly(ADP-ribosyl)transferase-like 1 protein, which is capable of catalyzing a poly(ADP-ribosyl)ation reaction. This protein has a catalytic domain which is homologous to that of poly (ADP-ribosyl) transferase, but lacks an N-terminal DNA binding domain which activates the C-terminal catalytic domain of poly (ADP-ribosyl) transferase. Since this protein is not capable of binding DNA directly, its transferase activity may be activated by other factors such as protein-protein interaction mediated by the extensive carboxyl terminus. [provided by RefSeq, Jul 2008]. |
| Product Details | |
|---|---|
| Cell Line Model | HAP1 |
| Genotype | HAP1 cell line, edited by CRISPR/Cas to contain a 7bp insertion in a coding exon of PARP4. |
| Description | 7bp insertion |
| Parental Cell Line | C631 |
| Guide RNA Sequence | TGGTGGAGCTTCAGTGTTCG |
| PCR Primer |
Forward: GGTAAGAAGAAAAAGGTTGGGAGGT Reverse: TGCTCTCGGGATTTTAGGAGATTTT |
| Handling Specifications | |
|---|---|
| Revival | Rapidly thaw cells in a 37°C water bath. Transfer contents into a tube containing pre-warmed media. Centrifuge cells and seed into 10 mL of pre-warmed media in a 10 cm dish. |
| Culture Medium | IMDM + 10% FCS |
| Growth Properties | Cells are adherent cells that are cultured at 37°C in a humidified atmosphere with 5% CO2. Cells should be passaged every 2-3 days, splitting approximately 1:10-1:20. |
| Freeze Medium | IMDM + 20% FCS + 10% DMSO |
| Biosafety Level | BSL-1 |
| Disclaimer | This product is classified under IATA regulations as a GMMO (genetically modified micro-organism) and will ship as UN3245. If applicable, ensure facility meets all requirements per local and country regulations. |
For research use only. Not intended for any clinical use. No products from CD BioSciences may be resold, modified for resale or used to manufacture commercial products without prior written approval from CD BioSciences.